Customer Publications February 2026

· Persephone Fossi · About Golden Helix

February’s Clinical Genomics Insights Across Brain Tumors, Rare Missense Variants, and Genetic History of Cattle

Each month, we highlight new research from the scientific community that advances our understanding of complex genetic diseases and showcases the tools researchers rely on for precise variant interpretation. Our customer publications in February explored brain tumors, rare missense variants, and the genetic history of Philippine cattle. Together, these studies highlight the varied possible uses of VarSeq, GenomeBrowse, and SVS.


Title: Somatic Mutations in Nuclear and Mitochondrial Genes of Mitochondrial Proteins in Primary and Recurrent Glioblastoma

Background: Glioblastoma tumors are one of the deadliest, most aggressive tumors found in the brain. Molecular genetic and genomic alterations were recently added to histopathology for these tumors, changing how they are diagnosed and treated in clinical settings.

Objective: This study aimed to better define epigenomic and genomic profiles of glioblastoma DNA samples in order to track somatic mitochondrial (mt)DNA and nuclear mitochondrial gene mutations.

Subjects and methods: Whole exome and mtDNA sequencing were performed on ten samples of sequential glioblastoma DNA. Bioinformatics analysis was then performed on the resulting data to determine pathogenic or likely pathogenic variants.

Results: Mostly benign single nucleotide variants in several mtDNA genes remained largely stable over time, while a few potentially pathogenic mtDNA variants appeared in GBM-R samples, and in contrast, pathogenic or likely pathogenic variants in 29 nuclear genes, including an increasing number of protein-truncating variants, were detected and accumulated over time in GBM-P and GBM-R samples.

Conclusions: This study highlights the accumulation of mutations in nuclear genes encoding mitochondrial proteins across sequential GBM samples, suggesting that these variants may affect tumor metabolism, growth, invasiveness, and necrosis and warrant further comprehensive investigation.

How VarSeq Was Used: For mitochondrial and nuclear variant evaluation, the VarSeq software (v2.6.0; Golden Helix, Inc., Bozeman, MT, USA) was used for annotation and filtering of SNVs and INDELs. MtDNA and nDNA sequences from GBM pairs were uploaded as individual singletons. Only PASS-tagged variants were retained using the Low-Frequency Mitochondrial (mtDNA) Variant Caller and GATK FilterMutectCalls. Filtering criteria included a read depth ≥ 50 in both samples, while variant allele frequency (VAF) thresholds were ≥5% for mitochondrial variants and ≥15% for nuclear variants. Variants with entries in dbSNP (dbSNP Common 155, NCBI) were excluded. MtDNA variants with missing or ≤4 HRUN tag values (homopolymer length to the right of the reported indel position) were retained and a targeted gene panel (in Supplementary Table S1C) was used to focus on nuclear genes encoding mitochondrial proteins. As a final filtering step, mtDNA variants affecting both coding genes and short intergenic regions between genes were included for evaluation.

MtDNA variants identified by VarSeq were classified based on entries and in silico predictions in the MITOMAP database (https://www.mitomap.org/MITOMAP, accessed on 14 January 2026). nDNA variants identified by VarSeq were assessed according to the ACMG guidelines and the VarSeq’s autoclassification framework, which integrates population-frequency data, bioinformatic predictions, functional studies, segregation information, the published literature, clinical observations, and ClinVar entries (https://www.ncbi.nlm.nih.gov/clinvar/, accessed on 14 January 2026). Both the ACMG guideline and VarSeq autoclassification sort variants into benign, likely benign, VUS, likely pathogenic, and pathogenic categories. Most variants classified as pathogenic or likely pathogenic in the databases are supported by functional data in the literature. Variants assessed by VarSeq autoclassification, were cross-referenced by data in the ClinVar database.

Citation: Tompa, M., Galik, B., Urban, P., Gyenesei, A., & Kalman, B. (2026). Somatic Mutations in Nuclear and Mitochondrial Genes of Mitochondrial Proteins in Primary and Recurrent Glioblastoma. International Journal of Molecular Sciences27(4), 1773. https://doi.org/10.3390/ijms27041773


Title: A Missense Variant in ASCL5 Leads to Lobodontia

Background: Lobodontia is a rare dental condition that causes the teeth to grow sharp and conical, similar to those of a wolf, with the addition of a single pointed molar root. This condition, while rare, is more common in families of Eastern European descent, particularly those of Croatian or Czechoslovakian background. This study investigated the genetic background of the condition in seventeen patients, all of Croatian or Thai descent.

Objective: The purpose of this study was to determine the genetic cause of Lobodontia, which was previously thought to be linked to a variant in the CACNA1S gene.

Subjects and methods: Whole-genome sequencing and microsatellite genotyping were performed on six families, each comprising a mix of affected and unaffected individuals.

Results: The study found that the CACNA1S gene variant was present only in Thai families and in some family members who did not have the condition. However, they found that all seventeen patients with the condition presented with the ASCL5 c.274G>A (p.Glu92Lys) variant, while their family members without the condition lacked this variation.

Conclusions: It was found that the ASCL5 c.274G>A (p.Glu92Lys) variant was actually causing this lobodontia condition in patients, highlighting its importance in craniofacial development.

How GenomeBrowse Was Used: The vcf files were filtered and analyzed using Illumina BaseSpace Variant Interpreter version 2.17.0.60. Variants were filtered using the following criteria: 1. Passed the variant calling QC process, 2. Had read depth >10 with variant read frequency >20%, 3. Had allele frequency <1%
in gnomAD, TOPMed, and absent in the T-REx and in-house database of 3,109 exomes, 4. Located in the coding regions and canonical splice sites of the genes without silence consequences, and 5. Cosegregated with the phenotype. The pathogenicity of candidate variants was classified according to American College of Medical Genetics and Genomics (ACMG) standards and guidelines for variant interpretation. The candidate variant was validated by Sanger sequencing with the ASCL5 primers: F: GTCCTGGTACCCAAGAGCTG and R: GTCTCTATCGTGCCCATCGT. Exome and genome BAM files were visualized together with gene annotations using Golden Helix GenomeBrowse version 3.1.0

Citation: Theerapanon, T., Intarak, N.,Rattanapornsompong, K. et al. A missense variant in ASCL5 leads to lobodontia (2026). https://doi.org/10.1038/s41467-026-69323-1


Title: Genomic Insights into the Origins, Population Structure, and Local Adaptation of Philippine Visayan Native Cattle

Background: Cattle have been an important livestock animal in the Philippines since their introduction in the 1500s. However, despite their widespread use on the islands, it is not well known how the Philippine Visayan native cattle breed came to be, even though this breed is well adapted to its environment and a crucial livestock animal in its region.

Objective: This study aimed to understand the genetic background of the Visayan cattle breed compared to other cattle breeds in order to determine their genetic history.

Subjects and methods: Genome-wide SNP analysis using Golden Helix’s SNP Variation Suite was performed to analyze native Philippine Visayan cattle and compare them with global breeds. The genetic diversity of the cattle in the study was then analyzed and determine ancestral lineage.

Results: VNC shows low-to-moderate genetic diversity with signs of recent inbreeding in Siquijor, predominantly indicine ancestry bridging mainland Southeast Asia and Southeastern China with minor Iberian taurine and South Asian indicine influence, and selection signatures linked to small stature, heat tolerance, immune robustness, and early reproductive performance, reflecting adaptation to the Philippines’ insular tropical conditions.

Conclusions: Overall, VNC populations in Panay and Siquijor display predominantly indicine ancestry with island-adapted physiological traits, highlighting the importance of conservation and island-specific breeding strategies to maintain local adaptation while controlling inbreeding.

How SVS Was Used: Since the two populations were genotyped using different platforms, only SNPs common to both 50k and HD were utilized. All data were merged, and SNP quality control was performed using the SNP Variation Suite (SVS; Golden Helix, Inc., Bozeman, MT, USA). The SVS Append function was used to merge datasets generated on different SNP arrays. Prior to merging, marker annotations were harmonized to a common reference genome assembly and a consistent marker naming scheme. The physical positions of the SNPs were mapped according to the ARS-UCD1.2 available from https://www.animalgenome.org/repository/cattle/UMC_bovine_coordinates/ (accessed on 1 March 2025). SVS then matched markers across datasets using the harmonized marker ID and physical position coordinates; markers that could not be unambiguously matched (i.e., non-overlapping or inconsistent entries) were excluded so that only the shared SNP set was retained in the final merged dataset.

Citation: Dominguez, J. M. D., Yebron, M. G. N., Jr., Banayo, J. B., Chen, N., Salces, A. J., & Kim, K. S. (2026). Genomic Insights into the Origins, Population Structure, and Local Adaptation of Philippine Visayan Native Cattle. Animals16(4), 539. https://doi.org/10.3390/ani16040539


Leave a comment

Persephone Fossi

About Persephone Fossi

Persephone Fossi is a Marketing and Sales Assistant at Golden Helix, joining the team last year. Persephone received her Bachelor's degree in Psychology from Montana State University in 2025. When she's not in the office, Persephone enjoys hiking, spending time with friends, hot yoga, and crafting.

View all posts by Persephone Fossi →